Filters
Question type

Study Flashcards

Many bases in DNA are susceptible to spontaneous deamination. Which of the standard bases in DNA CANNOT spontaneously deaminate?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Among the standard bases in DNA, which i...

View Answer

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:


A) cannot distinguish the template strand from the newly replicated strand.
B) changes both the template strand and the newly replicated strand.
C) corrects the DNA strand that is methylated.
D) corrects the mismatch by changing the newly replicated strand.
E) corrects the mismatch by changing the template strand.

F) A) and B)
G) A) and E)

Correct Answer

verifed

verified

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The four key features of the current mod...

View Answer

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis. (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

During DNA replication, the two strands ...

View Answer

What is NOT a process or characteristic associated with recA?


A) It binds to ssDNA.
B) It forms part of DNA polymerase V.
C) It is involved in the homologous genetic recombination.
D) It facilitates strand invasion in repair pathways.
E) It forms a dimer with single-stranded DNA binding protein (SSB) and single-stranded DNA.

F) All of the above
G) A) and B)

Correct Answer

verifed

verified

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the β\beta subunit of bacterial DNA polymerase III in that it:


A) facilitates replication of telomeres.
B) forms a circular sliding clamp to increase the processivity of replication.
C) has a 3ʹ \rightarrow 5ʹ proofreading activity.
D) increases the speed but not the processivity of the replication complex.
E) participates in DNA repair.

F) A) and B)
G) A) and C)

Correct Answer

verifed

verified

Which enzyme is NOT directly involved in methyl-directed mismatch repair in E. coli?


A) DNA glycosylase
B) DNA helicase II
C) DNA ligase
D) DNA polymerase III
E) exonuclease I

F) B) and C)
G) B) and E)

Correct Answer

verifed

verified

In E. coli replication, DNA gyrase does not require ATP hydrolysis to lower the linking number of its substrate. Why is this, and where does the energy come from?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

The statement in the question is incorre...

View Answer

Which process does NOT require the 5' to 3' exonuclease activity of Pol I in E. coli?


A) joining of Okazaki fragments
B) nucleotide-excision repair
C) base-excision repair
D) nick translation
E) All of these require the 5' to 3' exonuclease activity of Pol I.

F) C) and D)
G) A) and D)

Correct Answer

verifed

verified

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

An Okazaki fragment is a short segment o...

View Answer

Which process or aspect is NOT associated with RecBCD?


A) helicase activity
B) ATP hydrolysis
C) nuclease activity
D) sequence-specific binding interactions
E) generation of 5' overhangs

F) B) and C)
G) B) and E)

Correct Answer

verifed

verified

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:


A) coenzyme A.
B) coenzyme Q.
C) FADH-.
D) pyridoxal phosphate (PLP) .
E) thiamine pyrophosphate (TPP) .

F) C) and D)
G) B) and D)

Correct Answer

verifed

verified

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Recombination plays a crucial role in th...

View Answer

Which statement is FALSE?


A) In vitro, the strand-exchange reaction can include formation of a Holliday intermediate.
B) In vitro, the strand-exchange reaction is accompanied by ATP hydrolysis.
C) In vitro, the strand-exchange reaction may involve transient formation of a three- or four-stranded DNA complex.
D) In vitro, the strand-exchange reaction needs RecA protein.
E) In vitro, the strand-exchange reaction requires DNA polymerase.

F) A) and E)
G) All of the above

Correct Answer

verifed

verified

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

Nucleotide polymerization is a thermodyn...

View Answer

Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli: (a) DNA helicase; (b) primase; (c) the 3' \rightarrow 5' exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' \rightarrow 3' exonuclease activity of DNA polymerase I.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

(a) DNA helicase: DNA helicase is respon...

View Answer

Which phrase does NOT describe an aspect of the nucleotide addition reaction catalyzed by E. coli DNA Pol III?


A) activation of the 3' OH of the newly synthesized strand by a metal ion
B) a properly positioned phosphate
C) specific protein/base-pair interactions in the major groove
D) charge stabilization of all three phosphates on the substrate
E) All of these are important aspects of the addition reaction.

F) B) and C)
G) A) and E)

Correct Answer

verifed

verified

The Ames test is used to:


A) detect bacterial viruses.
B) determine the rate of DNA replication.
C) examine the potency of antibiotics.
D) measure the mutagenic effects of various chemical compounds.
E) quantify the damaging effects of UV light on DNA molecules.

F) A) and B)
G) B) and C)

Correct Answer

verifed

verified

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

During crossing over in meiosis, several...

View Answer

List three types of DNA damage that require repair.

Correct Answer

Answered by ExamLex AI

Answered by ExamLex AI

DNA is constantly subject to damage from...

View Answer

Showing 81 - 100 of 101

Related Exams

Show Answer